Chapter 11 miRNA
The miRDeep2 is one of the most popular tools for discovering known
and novel miRNAs from small RNA sequencing data. We have wrapped the
mapping and quantification steps into an Rcwl pipeline which is
ready to load and use. More details about miRDeep2 can be found
here: https://github.com/rajewsky-lab/mirdeep2.
## miRMapper loaded
## miRDeep2 loaded
Here We also use the data from the above GitHub repository as an example. https://github.com/rajewsky-lab/mirdeep2/tree/master/tutorial_dir
git2r::clone("https://github.com/rajewsky-lab/mirdeep2", "data/miRNA")
list.files("data/miRNA/tutorial_dir")11.0.1 Reference index
First, we need to build indexes for the miRNA reference with the
Rcwl tool bowtie_build. This is only required to be performed once
for each refernce genome.
## inputs:
## ref (File):
## outPrefix (string):
bowtie_build$ref <- "data/miRNA/tutorial_dir/cel_cluster.fa"
bowtie_build$outPrefix <- "cel_cluster"
idxRes <- runCWL(bowtie_build, outdir = "output/miRNA/genome",
showLog = TRUE, logdir = "output/miRNA")Then the indexed reference files are generated in the output directory
defined in outdir.
## Warning in file.create(to[okay]): cannot create file 'output/miRNA/genome/
## cel_cluster.fa', reason 'No such file or directory'
## [1] FALSE
## character(0)
11.0.2 Run miRDeep2 pipeline
To run the pipeline for all samples parallelly, we need to prepare the
inputs for arguments of inputList and paramList.
## inputs:
## reads (File):
## format (string): -c
## adapter (string):
## len (int): 18
## genome (File):
## miRef ( File|string ):
## miOther ( File|string ):
## precursors ( File|string ):
## species (string):
To mimic multiple samples, here we just repeat to use the input reads as if they are two different samples.
reads <- list(sample1 = "data/miRNA/tutorial_dir/reads.fa",
sample2 = "data/miRNA/tutorial_dir/reads.fa")
inputList <- list(reads = reads)
paramList <- list(adapter = "TCGTATGCCGTCTTCTGCTTGT",
genome = "output/miRNA/genome/cel_cluster.fa",
miRef = "data/miRNA/tutorial_dir/mature_ref_this_species.fa",
miOther = "data/miRNA/tutorial_dir/mature_ref_other_species.fa",
precursors = "data/miRNA/tutorial_dir/precursors_ref_this_species.fa",
species = "C.elegans")Let’s run the pipeline with two computing nodes.
mirRes <- runCWLBatch(miRDeep2PL, outdir = "output/miRNA",
inputList, paramList,
BPPARAM = BatchtoolsParam(
workers = 2, cluster = "multicore"))The results are collected in the output directory defined in the outdir.
## character(0)